View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1511_low_153 (Length: 250)

Name: NF1511_low_153
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1511_low_153
NF1511_low_153
[»] chr8 (1 HSPs)
chr8 (12-250)||(32483286-32483524)


Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 32483524 - 32483286
Alignment:
12 atgaaatatggtggagattttaagcttgaacataaacacacgcaatcgatacggttggattgttagcagatatagttccaaaactatgtcatcagtattt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32483524 atgaaatatggtggagattttaagcttgaacataaacacacgcaatcgatacggttggattgttagcagatatagttccaaaactatgtcatcagtattt 32483425  T
112 ggctatctttttcagagaattcctctaaaccaaaagattctctctttgtttttgctttcctttatttcaccactcactctcttaaccataacactgaaaa 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
32483424 ggctatctttttcagagaattcctctaaaccaaaagattctctctttgtatttgctttcctttatttcaccactcactctcttaaccataacactgaaaa 32483325  T
212 ggttcaatcacggaaactgctagtgcttctgcttaatac 250  Q
    || |||||||||||||||||||||||||||| |||||||    
32483324 gggtcaatcacggaaactgctagtgcttctgattaatac 32483286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University