View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_155 (Length: 249)
Name: NF1511_low_155
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_155 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 147 - 237
Target Start/End: Complemental strand, 39382815 - 39382725
Alignment:
| Q |
147 |
cacacgcttaatgagattgagagagtataccttcaagtgggatgagtttagagccagatttacagtaaacaaggccttgaacaccaatatt |
237 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39382815 |
cacacgattaatgatattgagagagtataccttcaagtgggatgagtttagagccagatttacagtaaacaaggccttgaacaccaatatt |
39382725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 39382947 - 39382875
Alignment:
| Q |
18 |
aaatggttttaattttaaaacttacnnnnnnnntagttataatcttactaaaacattattacgggttttagaa |
90 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39382947 |
aaatggttttaattttaaaacttacaaaaaaaatagttataatcttactaaaacattattacgggttttagaa |
39382875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University