View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1511_low_161 (Length: 245)

Name: NF1511_low_161
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1511_low_161
NF1511_low_161
[»] chr5 (1 HSPs)
chr5 (1-227)||(40790757-40790982)


Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 40790982 - 40790757
Alignment:
1 ttggttactctgcatattcatggaggtgaagaatattggtggggaacaaatcattnnnnnnnngtaagataattaaggatcttttacaatatgcctttgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||    
40790982 ttggttactctgcatattcatggaggtgaagaatattggtggggaacaaatcattaaaaaaaagtaagataattaaggatcttttacaatatgcctttgc 40790883  T
101 atattatatggacccttctcccacgtatggccacatctacatatatatgaagnnnnnnnnncatgaatggaatttttagcactgaagtgagaaagaatct 200  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||         ||||||||||||||||||||||||||| |||||||||||    
40790882 atattatatggacccttctcccacgtatggccacaactacatatatatgaag-aaaaaaaacatgaatggaatttttagcactgaagtaagaaagaatct 40790784  T
201 ttagtattttgatcgatgaccccatct 227  Q
    ||||||||||||| |||||||||||||    
40790783 ttagtattttgattgatgaccccatct 40790757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University