View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_171 (Length: 239)
Name: NF1511_low_171
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_171 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 1589596 - 1589803
Alignment:
| Q |
14 |
tgtatttgccacttcattttagaaaaattgattaaatatttcaaattaactctataattgcttatttatagtnnnnnnnnncactaaattgcatatacat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
1589596 |
tgtatttgccacttcattttagaaaaattgattaaatatttcaaattaactctataattgcttatttatagtaaaataaa-ctctaaattgcatatacat |
1589694 |
T |
 |
| Q |
114 |
tttgagaaaagataacatgtgaccaattaattctcttaccttctgagaacgtgaacaggtggcccccgtgctcatcaaaactcatagcaatactacttat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1589695 |
tttgagaaaagataacatgtgaccaattaattctcttaccttctgagaacgtgaacaggtggcccccgtgctcatcaaaactcatagtaatactacttac |
1589794 |
T |
 |
| Q |
214 |
gtttcatgg |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
1589795 |
gtttcatgg |
1589803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University