View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_183 (Length: 235)
Name: NF1511_low_183
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_183 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 201
Target Start/End: Original strand, 36476557 - 36476747
Alignment:
| Q |
11 |
aagaatataatgatgatatttgcacgtctatatgcatggccccaggaactataataatataagctgaaaaataattgaagttatttattgtagactttgg |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36476557 |
aagaaaataatgatgatatttgcacgtctatatgcatggccccaggaactataataatataagctgaaaaataattgaagttatttattatagactttgg |
36476656 |
T |
 |
| Q |
111 |
tgtcaagtcgctttcttaagcattccaaatccctatagaatagaatactcataagccaacttcatacgtgctgctgagtgttgatctccat |
201 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36476657 |
tgtcaagtcgctttcttaagcattcccaatccctatagaatagaatactcataagccaacttcatacgtgctgctgagtgttgatctccat |
36476747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University