View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_184 (Length: 234)
Name: NF1511_low_184
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_184 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 224
Target Start/End: Original strand, 485696 - 485902
Alignment:
| Q |
18 |
ctatgttcacgcttaaaactaacatggcctgaattcaattcaaatagccaacatcaaatcctgaattctaacttttgaaagtcaaagttcttgttctgag |
117 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
485696 |
ctatgtttacgcttaaaactaacatgacctgaattcaattcaaatagccaacatcaaatcctgaattctaacttttgaaagtcaaagttcttgttctgaa |
485795 |
T |
 |
| Q |
118 |
ttttaaaagaatggaaaaactttgtccccagcccttatttttccatctacatacaagatctcaatatattcactaattttttaaatgacagcatgcttca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
485796 |
ttttaaaagaatggaaaaactttgtccctagcccttatttttccatctacatacaagatctcaatatattcactaattttttaaatgacagcatgcttct |
485895 |
T |
 |
| Q |
218 |
tctcact |
224 |
Q |
| |
|
||||||| |
|
|
| T |
485896 |
tctcact |
485902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University