View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_185 (Length: 234)
Name: NF1511_low_185
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_185 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 26666868 - 26666652
Alignment:
| Q |
18 |
aaaccgtacaagttacaacccaattacttgagaaagatcagaattgcaatacaaacaggaaccaaaaagttgctgctaaaatggtagatagaagaaccaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26666868 |
aaaccgtacaagttacaacccaattacttgagaaagatcagaattgcaatacaaacaggaaccaaaaagttgctgctaaaatggtagatagaagaaccaa |
26666769 |
T |
|
| Q |
118 |
gcaaagtccacaaacagaagctaacctccttgtgcaaaaccagaaaacagagaatgtcaccactcttacctcatcaaccaaatacaaatctcagagtcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26666768 |
gcaaagtccacaaacagaagctaacctccttgtgcaaaaccagaaaacagagaatgtcaccactcttacctcatcaaccaaatacaaatctcagagtcat |
26666669 |
T |
|
| Q |
218 |
cctaagtaactacttct |
234 |
Q |
| |
|
||| ||| ||||||||| |
|
|
| T |
26666668 |
ccttagtcactacttct |
26666652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University