View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_192 (Length: 232)
Name: NF1511_low_192
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_192 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 50 - 200
Target Start/End: Original strand, 43602004 - 43602155
Alignment:
| Q |
50 |
ttagagatcttgagttataatctaaaggaaggagaaaaatttaatctaaaaatggatcatttttnnnnnnnnnnnnn-ctccaacaatcctattagatct |
148 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
43602004 |
ttagaggtcttgagttataatctaaaggaaggaaaaaaatttaatctaaatatggatcatttaaaaaaaaaaaaaaaactccaacaatcctattagatct |
43602103 |
T |
 |
| Q |
149 |
tctcttaccctaccatctttttcagccgtcaacattgatcaatgccgggttc |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602104 |
tctcttaccctgccatctttttcagccgtcaacattgatcaatgccgggttc |
43602155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University