View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_193 (Length: 232)
Name: NF1511_low_193
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_193 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 48834015 - 48833815
Alignment:
| Q |
16 |
ttttatacaaaaatcaaatttacattctctcgaacaattcattttcatgagaaactcattaaccacctaatttcaaatacttggtttatgatttcactta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48834015 |
ttttatacaaaaatcaaatttacattctcttgaacaattcgttttcgtgagaaactcattaaccacctaatttcaaatacttggtttatgatttcactta |
48833916 |
T |
 |
| Q |
116 |
tattattttctatatcaatttgaattctgtcaactatgtttctttgcccatcatcagtttaccaatttacgaaattaggacaatattttgtaacttctat |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48833915 |
tattcttttctatatcaatttgaattctgtcaactatgtttctttgcccatcttcagtttaccaatttacgaaattaggacaatattttgtaacttctat |
48833816 |
T |
 |
| Q |
216 |
a |
216 |
Q |
| |
|
| |
|
|
| T |
48833815 |
a |
48833815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University