View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_198 (Length: 221)
Name: NF1511_low_198
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_198 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 44154358 - 44154170
Alignment:
| Q |
16 |
aatataatacaaagacccagcccaagcccaataataaaaagtgagcaacgttgcttaaaagtgaaaattttcaatttttcacgtcacgtggtaacatgat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44154358 |
aatataatacaaagacccagcccaagcccaataataaaaagtgagcaacgttgcttaaaaatgaaaaatttcaatttttcacgtcacgtggtaacatgat |
44154259 |
T |
 |
| Q |
116 |
gattgttacctctgaatccgaacaaactatcttactctgaatccgacaacatcatcgtcctagtcgatgttcttgaagatgaacaacct |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44154258 |
gattgttacctctgaatccgaacaaactatcttactctgaatccgacaacatcatcgtcctcgtcgatgttcttgaagatgaacaacct |
44154170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University