View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1511_low_199 (Length: 220)

Name: NF1511_low_199
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1511_low_199
NF1511_low_199
[»] chr2 (1 HSPs)
chr2 (14-204)||(41783922-41784112)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 41784112 - 41783922
Alignment:
14 attattctgaatccctttaaccacattagcgtaggtttttgtcttccaacaaggtgtagctggtggagatgaatccagagatgacccttctgagctccct 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41784112 attattctgaatccctttaaccacattagcgtaggtttttgtcttccaacaaggtgtagctggtggagatgaatccagagatgacccttctgagctccct 41784013  T
114 tggttacaactcatcggtgaccacagagttgaatctggtgaactaattaaatcccatgactacacgaaaaggaagaaagaaaccacataac 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41784012 tggttacaactcatcggtgaccacagagttgaatctggtgaactaattaaatcccatgactacacgaaaaggaagaaagaaaccacataac 41783922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University