View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_202 (Length: 216)
Name: NF1511_low_202
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_202 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 47 - 201
Target Start/End: Complemental strand, 23693307 - 23693153
Alignment:
| Q |
47 |
tagacatgtttatacaactaaatgtagttttaatacaatattcagcatttattttgaaatagttcaaaaattgtagaccagaacacagtttttcagcatt |
146 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23693307 |
tagatatgtttatacaactaaatgcagttttaatacaatattcagcatttattttgaaatagttcaaaaattgtagaccagaacacagtttttcagcatt |
23693208 |
T |
|
| Q |
147 |
ttcatcactaaaatttccaccatttcattttcagttgtaccaagcttgcctaaat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23693207 |
ttcatcactaaaatttccaccatttcattttcagttgtaccaagcttgcctaaat |
23693153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 197
Target Start/End: Complemental strand, 23747497 - 23747444
Alignment:
| Q |
144 |
attttcatcactaaaatttccaccatttcattttcagttgtaccaagcttgcct |
197 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
23747497 |
attttcatcactgaaaattccaccatttcatttttagttgtaccaagcatgcct |
23747444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University