View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1511_low_206 (Length: 202)

Name: NF1511_low_206
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1511_low_206
NF1511_low_206
[»] chr4 (1 HSPs)
chr4 (61-186)||(25394068-25394193)
[»] chr5 (1 HSPs)
chr5 (1-66)||(14244654-14244719)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 61 - 186
Target Start/End: Original strand, 25394068 - 25394193
Alignment:
61 ttggttaactatttgatcatttcatttcaactttggtgtctccattttttgttgttttgatgttatattctgtaaagtattctgggtggtggaacgttgt 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||    
25394068 ttggttaactatttgatcatttcatttcaactttggtgtctccattttttgttgttttgatgttacattctgtaaagtattttgggtggtggaacgttgt 25394167  T
161 aaaatgttcttaatgtctctggcttc 186  Q
    |||||||||||||||||| |||||||    
25394168 aaaatgttcttaatgtctttggcttc 25394193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 14244654 - 14244719
Alignment:
1 cttcaaagacatggaggcaactgagcgtcgtttcatacaatatccgctggttcatcaggattggtt 66  Q
    |||| ||||||||||| ||||||| | || |||||| |||| ||| ||||||||||||| ||||||    
14244654 cttccaagacatggagtcaactgatcttcttttcatgcaatgtcctctggttcatcaggcttggtt 14244719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University