View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_206 (Length: 202)
Name: NF1511_low_206
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_206 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 61 - 186
Target Start/End: Original strand, 25394068 - 25394193
Alignment:
| Q |
61 |
ttggttaactatttgatcatttcatttcaactttggtgtctccattttttgttgttttgatgttatattctgtaaagtattctgggtggtggaacgttgt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
25394068 |
ttggttaactatttgatcatttcatttcaactttggtgtctccattttttgttgttttgatgttacattctgtaaagtattttgggtggtggaacgttgt |
25394167 |
T |
 |
| Q |
161 |
aaaatgttcttaatgtctctggcttc |
186 |
Q |
| |
|
|||||||||||||||||| ||||||| |
|
|
| T |
25394168 |
aaaatgttcttaatgtctttggcttc |
25394193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 14244654 - 14244719
Alignment:
| Q |
1 |
cttcaaagacatggaggcaactgagcgtcgtttcatacaatatccgctggttcatcaggattggtt |
66 |
Q |
| |
|
|||| ||||||||||| ||||||| | || |||||| |||| ||| ||||||||||||| |||||| |
|
|
| T |
14244654 |
cttccaagacatggagtcaactgatcttcttttcatgcaatgtcctctggttcatcaggcttggtt |
14244719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University