View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_207 (Length: 201)
Name: NF1511_low_207
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_207 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 25 - 184
Target Start/End: Original strand, 52031161 - 52031320
Alignment:
| Q |
25 |
tctttttctttgaatttcattccatgtcgccaacaacgaatagcttctaactattcggatctctgtgctgtgctttgagtgttgaattttgagttttgag |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52031161 |
tctttttctttgaatttcattccatgtcgccaacaacgaatagcttctaactattcggatctctgtgctgtgctttgagtgttgaattttgagttttgag |
52031260 |
T |
 |
| Q |
125 |
cgatggcagcagcacctgcaagagctcgtgccgattacgattacctcatcaagcttcttc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52031261 |
cgatggcagcagcacctgcaagagctcgtgccgattacgattacctcatcaagcttcttc |
52031320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 124 - 182
Target Start/End: Complemental strand, 29351905 - 29351847
Alignment:
| Q |
124 |
gcgatggcagcagcacctgcaagagctcgtgccgattacgattacctcatcaagcttct |
182 |
Q |
| |
|
|||||||| || |||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
29351905 |
gcgatggctgctccacctgcaagagctcgatccgattacgattatctcatcaagcttct |
29351847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 182
Target Start/End: Complemental strand, 29344161 - 29344116
Alignment:
| Q |
137 |
cacctgcaagagctcgtgccgattacgattacctcatcaagcttct |
182 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
29344161 |
cacctgcaagagctcgatccgattacgattacctaatcaagcttct |
29344116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 182
Target Start/End: Complemental strand, 23386753 - 23386708
Alignment:
| Q |
137 |
cacctgcaagagctcgtgccgattacgattacctcatcaagcttct |
182 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
23386753 |
caccggcaagggctcgtgccgattacgattacctcattaagcttct |
23386708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University