View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_36 (Length: 454)
Name: NF1511_low_36
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 288
Target Start/End: Original strand, 11900767 - 11901052
Alignment:
| Q |
13 |
tagggcaaatgaatcttatgcatgtccttaagattagagattggttctaccatgtaatttaatgatttactcacttttttgtgaaattcatctttgtcac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11900767 |
tagggcaaatgaatcttatgcatgtccttaagattagagattggttctaccatgtaatttaatgatttactcacttttttgtgaaattcatctttgtcaa |
11900866 |
T |
|
| Q |
113 |
catactaattttgtatcaattgtcataatctaggnnnnnnnnnnagtcagcatataatattgcaacaaacccggcacaaggtgtactaaacgggta-gcg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
11900867 |
catactaattttgtatcaattgtcataatctaggtttttttttgaatcagcatatattattgcaacaaacccggcacaaggcgtactaaacgggtaggcg |
11900966 |
T |
|
| Q |
212 |
aaactttacaaccaaagaacaacaaaagccaaaactgctt---------cagcagagcagttgctgtcaagcaactacaacacacc |
288 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11900967 |
aaacattacaaccaaagaaccacaaaagccaaaactgcttcagcagtagcagcagagcagttgctgtcaagcaactacaacacacc |
11901052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 42 - 141
Target Start/End: Original strand, 5086743 - 5086842
Alignment:
| Q |
42 |
aagattagagattggttctaccatgtaatttaatgatttactcacttttttgtgaaattcatctttgtcaccatactaattttgtatcaattgtcataat |
141 |
Q |
| |
|
|||||||||||| ||||| ||||||| |||| ||| |||||||||||||| |||||||||||||| |||| | | ||||||||| |||||||||||| |
|
|
| T |
5086743 |
aagattagagatgggttcagccatgtagtttatagatcgactcacttttttgtaaaattcatctttgtgaccaaagtgattttgtattaattgtcataat |
5086842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University