View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15120_high_17 (Length: 246)
Name: NF15120_high_17
Description: NF15120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15120_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 388838 - 389005
Alignment:
| Q |
20 |
gttatggctcaaagtagcaaatgctcactttaaatttttccatggcgtgatgacttgtaagaaacggggaaatgcaatttctatgacaaagtggaaagag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
388838 |
gttatggctcaaagtagcaaatgctcactctaaatttttccatggcgtgatgactcgtaagaaacggggaaatgcaatttctatgacaaagtggaaagag |
388937 |
T |
 |
| Q |
120 |
taaccaatgttt-aaatgacgtgttcacacattttaattataatttccggtatgttcttcttgtgcga |
186 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
388938 |
taaccaatgtttaaaatgatgtgttcacacattttaattataatttccggtatgtttttcttgagcga |
389005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 185 - 226
Target Start/End: Original strand, 389087 - 389128
Alignment:
| Q |
185 |
gaggttaagatgacagtttgagattgtgatatttttaagagt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
389087 |
gaggttaagatgacagtttgagattgtgatatttttaagagt |
389128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University