View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15120_high_18 (Length: 246)

Name: NF15120_high_18
Description: NF15120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15120_high_18
NF15120_high_18
[»] chr3 (1 HSPs)
chr3 (182-230)||(20753109-20753157)


Alignment Details
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 20753109 - 20753157
Alignment:
182 aaccatatacatgcataaatgttttaactatatgaacttttatatattt 230  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||    
20753109 aaccatatacatgcataaatgttttaactatatgaacttttataaattt 20753157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University