View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15120_low_22 (Length: 245)
Name: NF15120_low_22
Description: NF15120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15120_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 5 - 190
Target Start/End: Original strand, 47340089 - 47340274
Alignment:
| Q |
5 |
ctggttctactgcagaagtaactcttatgacattagtatcagtttattcattcacagaatcatatgtaaccgtcaagatgcatcatttcaccaaaatatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47340089 |
ctggttctactgcagaagtaactcttatgacattagtatcagtttattcattcacagaatcatatgtaaccgtcaagatgcatcatttcaccaaaatatt |
47340188 |
T |
|
| Q |
105 |
gaatcattatgcgtatcttggtgatactttaattttggtgatctaaccactgtgggtatctctggactagatatcgtaatcttgtc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47340189 |
gaatcattatgcgtatcttggtgatactttaattttggtggtctaaccattgtgggtatctctggactagatatcgtaatcttgtc |
47340274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University