View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15121_low_3 (Length: 359)
Name: NF15121_low_3
Description: NF15121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15121_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 23 - 355
Target Start/End: Original strand, 35915905 - 35916237
Alignment:
| Q |
23 |
agtattgttcaagattgtgtttgtgatgatataactgatgatgatttgcatgaacttaaaggatgcattgaacttgggtttggattcaatgaagaagatg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915905 |
agtattgttcaagattgtgtttgtgatgatataactgatgatgatttgcatgaacttaaaggatgcattgaacttgggtttggattcaatgaagaagatg |
35916004 |
T |
|
| Q |
123 |
gtcagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagccctgtttctacacctcaaagtcgtgcttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916005 |
gtcagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagccctgtttctacacctcaaagtcgtgcttc |
35916104 |
T |
|
| Q |
223 |
atcccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagcccaggttaactttctttgcatttttcttaa |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916105 |
atcccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagcccaggttaactttctttgcatttttcttaa |
35916204 |
T |
|
| Q |
323 |
caatcannnnnnngccttaatcctttgcttctc |
355 |
Q |
| |
|
|||||| |||||||||||||| ||||| |
|
|
| T |
35916205 |
caatcatttttttgccttaatcctttggttctc |
35916237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University