View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15123_low_10 (Length: 294)
Name: NF15123_low_10
Description: NF15123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15123_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 22 - 237
Target Start/End: Complemental strand, 54918286 - 54918074
Alignment:
| Q |
22 |
atgggaataaaaatttgtttgttttgatgcatgaatttaaaggtggcacaaaacatagaggaatttagtgacgaaagcatgagatcaaatggaaataaag |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54918286 |
atgggaataaaaatttgtttgttttgatgcatgaatttaaaggtgacacaaaacatagaggaatttagtgacgaaagcatgagatcaaatggaaataaag |
54918187 |
T |
|
| Q |
122 |
ccaaatgagacgaacattataaatccattgtgtctttgggaccttattcaagctggaacttttatatgagattatactagggttgttttgactaggtagc |
221 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54918186 |
ccaaatgagacgaac---ataaatccattgtgtctttgggaccttattcaagctggaactcttatatgagattatactagggttgttttgactaggtagc |
54918090 |
T |
|
| Q |
222 |
aagcacaaacttccac |
237 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
54918089 |
aagcacaaacttccac |
54918074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 236 - 284
Target Start/End: Complemental strand, 54918037 - 54917989
Alignment:
| Q |
236 |
acgatttttgaatactagatgggatgaacaatggggtgatctgtctctg |
284 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
54918037 |
acgatttttgaatactaggtgggatgaacaatggggtgatttgtctctg |
54917989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 78 - 122
Target Start/End: Original strand, 54911745 - 54911789
Alignment:
| Q |
78 |
agaggaatttagtgacgaaagcatgagatcaaatggaaataaagc |
122 |
Q |
| |
|
||||||||||| ||| || |||||| ||||||||||||||||||| |
|
|
| T |
54911745 |
agaggaatttaatgaggagagcatgggatcaaatggaaataaagc |
54911789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University