View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15123_low_11 (Length: 288)
Name: NF15123_low_11
Description: NF15123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15123_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 25 - 167
Target Start/End: Original strand, 13869898 - 13870037
Alignment:
| Q |
25 |
taatatgtaaccaaccaagcaccttaattagaccataccttgaaggcaaactgacaatgaaggaaaatatgtgaggagatttcagccctcagattgcaga |
124 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13869898 |
taatatgtaaccaaccaagcacctta----gaccataccttgaaggcaaactgacaatgaaggaaaatatgtgaggagatttcagccctcagattgcaga |
13869993 |
T |
|
| Q |
125 |
aaacacaattcactgagtcatctaaaggc-aaactctcctcctt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13869994 |
aaacacaattcactgagtcatctaaaggcaaaactctcctcctt |
13870037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 164 - 272
Target Start/End: Original strand, 13870096 - 13870204
Alignment:
| Q |
164 |
cctttgtaggagccaggcttttccaaacggacccaaacaccctttctttggtaccacacaattcctctctcggtatcaacaaattctccaagatcttgta |
263 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13870096 |
cctttgtagaagccaggcttttccacacggacccaaacaccctttctttggtaccacacaattcctctctcggtatcaacaaattctccaagatcttgta |
13870195 |
T |
|
| Q |
264 |
ggttgaact |
272 |
Q |
| |
|
||||||||| |
|
|
| T |
13870196 |
ggttgaact |
13870204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University