View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15123_low_18 (Length: 229)
Name: NF15123_low_18
Description: NF15123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15123_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 23 - 213
Target Start/End: Complemental strand, 21853160 - 21852969
Alignment:
| Q |
23 |
gcaagatgattcagtatcatatatactactctttatggagtagcatcaaagatgaatacaatgcgattaaagagaattcagtttggctgcttggcaaagg |
122 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21853160 |
gcaagatgattcagtatcatatatactcctctttatggagtagcatcaaagatgaatacaatgtgattaaagagaattcagtttggctgcttggcaaagg |
21853061 |
T |
 |
| Q |
123 |
agataaaataaacttctgg-aatgactattggtgtggtcagtctcttgccactctttttaatatcgcagatcacatttctagtcttctcaca |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21853060 |
agataaaataaacttctggtaatgactattggtgtggtcagtctcttgcttctctttttaatatcccagatcacatttctagtcttctcaca |
21852969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University