View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15123_low_19 (Length: 227)

Name: NF15123_low_19
Description: NF15123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15123_low_19
NF15123_low_19
[»] chr6 (1 HSPs)
chr6 (7-227)||(3225305-3225525)


Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 3225525 - 3225305
Alignment:
7 agttgttggaggtgcaaagccgattgggctgcgaatcgatttcaattagccaagtgtagtaagggctttggaagaaaggcaactggtgggcttggaggtc 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
3225525 agttgttggaggtgcaaagccgattgggctgcgaatcgatttcaattagccaagtgtagtaagggctttggaagaaagacaactggtgggcttggaggtc 3225426  T
107 caatctatgtggtcactgatgagtctgataatgacatggtaaaccctaaacctggaacccttagatttggtgttgtccaaaagggaccattatggatcac 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
3225425 caatctatgtggtcactgatgagtctgataatgacatggtaaaccctaaacctggaacccttagatttggtgctgtccaaaagggaccattatggatcac 3225326  T
207 ttttgcacgtagcatggtcat 227  Q
    |||||||||||||||||||||    
3225325 ttttgcacgtagcatggtcat 3225305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University