View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15124_high_12 (Length: 306)
Name: NF15124_high_12
Description: NF15124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15124_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 152 - 256
Target Start/End: Original strand, 41866389 - 41866493
Alignment:
| Q |
152 |
ctgattttgtagaagtttcttttttgggttgttgatcttggcgagcaaaagccatgaaaacaaagttgttgcgataggcaaatgtgacctttgatcagaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41866389 |
ctgattttgtagaagtttcttttttgggttgttgatcttggcgagcaaaaaccatgaaaacaaagttgttgcgataggcaagtgtgacctttgatcagaa |
41866488 |
T |
|
| Q |
252 |
agatg |
256 |
Q |
| |
|
||||| |
|
|
| T |
41866489 |
agatg |
41866493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University