View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15124_high_17 (Length: 219)
Name: NF15124_high_17
Description: NF15124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15124_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 41571181 - 41570990
Alignment:
| Q |
12 |
aagaatatgatgagactgcacttatatttccagtaaactgattatttgatagatccaacattgtcaaagatggtatggataaacaccatgaaggaatttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41571181 |
aagaatatgatgagactgcacttatatttccagtaaactgattatttgatagatccaacattgtcaaagatggtatggataaacaccatgaaggaatttt |
41571082 |
T |
 |
| Q |
112 |
tccacttagtaaattgttatttaatagtaaataacctaagttttgaaaccctgttattttgttgggtagaggaccctttaatttattataag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41571081 |
tccacttagtaaattgttatttaatagtaaataacctaagttttgaaaccctgttattttgttgggtagaggaccctttaatttattataag |
41570990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 119
Target Start/End: Original strand, 30019877 - 30019982
Alignment:
| Q |
12 |
aagaatatgatgagactgcacttatatttccagtaaactgattatttgatagatccaacattgtcaaagatggtatggataaacaccatgaaggaatttt |
111 |
Q |
| |
|
||||| ||||||||| ||||||| |||||| ||||| | ||| ||||||||||||| |||||| |||||||| ||||||| ||||||| |||||| |
|
|
| T |
30019877 |
aagaacatgatgagattgcacttctatttcttgtaaatttatt--ttgatagatccaatcttgtcatagatggtaaatataaacatcatgaagaaatttt |
30019974 |
T |
 |
| Q |
112 |
tccactta |
119 |
Q |
| |
|
|||||||| |
|
|
| T |
30019975 |
tccactta |
30019982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University