View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15124_high_7 (Length: 362)
Name: NF15124_high_7
Description: NF15124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15124_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 12 - 293
Target Start/End: Original strand, 42030629 - 42030910
Alignment:
| Q |
12 |
tactgccatgttttgtcaacattcgagctgtttccattaattaagaagtcattcttgttgcctcttcatcatacgacattaaagcatgccagagaccgat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42030629 |
tactgccatgttttgtcaacattcgagctgtttccattaattaagaagtcattcttgttgcctcttcatcatacgacattaaagcatgccagagaccgat |
42030728 |
T |
 |
| Q |
112 |
gaggaggaacataaaacatgcgatgcgaccatttttcttttctttaaaactgaaaatattaatattatgaactcaagggtttgtttatactataattttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42030729 |
gaggaggaacataaaacatgcgatgcgaccatttttcttttctttaaaactgaaaatattaatattatgaactcaagggtttgtttatactataattttg |
42030828 |
T |
 |
| Q |
212 |
tacaaataattacaaacaatattttggttattattttgtttaaagtgaccggtttgcatgaattttagttcttttattttac |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42030829 |
tacaaataattacaaacaatattttggttattattatgtttaaagtgaccggtttgcatgaattttagttcttttattttac |
42030910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 318 - 346
Target Start/End: Original strand, 42030933 - 42030961
Alignment:
| Q |
318 |
gtgaaatagtagttcctagtctttgtttg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42030933 |
gtgaaatagtagttcctagtctttgtttg |
42030961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University