View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15124_low_14 (Length: 284)
Name: NF15124_low_14
Description: NF15124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15124_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 19 - 202
Target Start/End: Complemental strand, 5061198 - 5061010
Alignment:
| Q |
19 |
atatctcgtgcagtgtgagtgtggtcagaactcagaagcacttggttcatcccacct-----accctctttttgatcaatccacctactgaatttattat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5061198 |
atatctcgtgcagtgtgagtgtggtcagaactcagaagcacttggttcatcccaccccacccaccctctttttgatcaatccacctactgaatttattat |
5061099 |
T |
|
| Q |
114 |
tttcaatgtttatgtcaattctcaatttattttaaccattgttttcccccacccactggccacttccttaatttcatctgaacaagttc |
202 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5061098 |
tttcaatgtttatgttaattctcaatttattttacccattgtttttccccacacactggccacttccttaatttcatctgaccaagttc |
5061010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University