View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15126_high_52 (Length: 224)
Name: NF15126_high_52
Description: NF15126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15126_high_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 214
Target Start/End: Complemental strand, 35865979 - 35865784
Alignment:
| Q |
19 |
accttaccatagacaaatataaggcattgatggattatattaaattcttttacaagcatggatggtagagtatttggggcctgatcattaaaactgagaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35865979 |
accttaccatagacaaatataaggcattgatggattatattaaattcttttacaagcatggatggtagagtatttggggcctgatcattaaaactgagaa |
35865880 |
T |
 |
| Q |
119 |
ctgtgaaagtcctcgcaaactgtttatgctttcctgtccaactgttttctatgctttttctatactaacatcgtttgaatttggatgacctatgct |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35865879 |
ctgtgaaagtccttgcaaactgtttatgctttcctgtccaactgttttctatgctttttctatactaacatcgtttgaatttggatgatctatgct |
35865784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 87 - 204
Target Start/End: Complemental strand, 34815695 - 34815579
Alignment:
| Q |
87 |
agtatttggggcctgatcattaaaactgagaactgtgaaagtcctcgcaaactgtttatgctttcctgtccaactgttttctatgctttttctatactaa |
186 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||| ||||| |||| ||| ||||||| |||||||||||| | ||||||| ||| ||||||||||||| |
|
|
| T |
34815695 |
agtatttggggtctgatcaacaaaactgaaaactatgaaaatccttgcagactgtttctgctttcctgtcttatggttttctgtgc-ttttctatactaa |
34815597 |
T |
 |
| Q |
187 |
catcgtttgaatttggat |
204 |
Q |
| |
|
|| |||| ||||||||| |
|
|
| T |
34815596 |
cactgtttaaatttggat |
34815579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 214
Target Start/End: Original strand, 34839897 - 34839952
Alignment:
| Q |
158 |
aactgttttctatgctttttctatactaacatcgtttgaatttggatgacctatgct |
214 |
Q |
| |
|
||||||||||||||||||| ||| || |||||||||||||||||||| | ||||||| |
|
|
| T |
34839897 |
aactgttttctatgctttt-ctacaccaacatcgtttgaatttggattatctatgct |
34839952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University