View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15126_high_53 (Length: 221)
Name: NF15126_high_53
Description: NF15126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15126_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 8084568 - 8084759
Alignment:
| Q |
16 |
atgaataactctacctatttttgttgatggataaattaaataacaattagc-taggaacttagaatggtgcttaggatatcagctagcatttagcatgca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8084568 |
atgaataactctacctatttttgttgatggataaattaaataacaatttgcctaggaacttagaatggtgcttaggatatcagctagcatttagcatgca |
8084667 |
T |
 |
| Q |
115 |
gttgatgatgagaactttgaggtccaatacttttcaatatcttctggggttcttccagggattcttccagcaatgagatgccatctacaatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8084668 |
gttgatgatgagaactttgaggtccaatacttttcaatatcttctggggttcttccagggattcttccagcaatgagatgccatctacaatt |
8084759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University