View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15126_low_28 (Length: 333)
Name: NF15126_low_28
Description: NF15126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15126_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 18 - 319
Target Start/End: Complemental strand, 54496795 - 54496494
Alignment:
| Q |
18 |
gaaacccccaaccacatgatgaatccaagaccagcagcagcacctttattaccggacgaatttggtgacggtgaaggcgaaggtggcataggcattgtaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54496795 |
gaaacccccaaccacatgatgaatccaagaccagcagcaccacctttattaccggacgaatttggtgacggtgaaggcgaaggtggcataggcattgtaa |
54496696 |
T |
|
| Q |
118 |
ttagaggtgggagaactaggtcatgcttgttttggacaacgacagccagctttaatcccatcttgcaatgacgctttgttccacttatgaaatgatatac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54496695 |
ttagaggtgggagaactaggtcatgcttgttttggacaacgacagccagctttaatcccatcttgcaatgacgctttgttccacttatgaaatgatatac |
54496596 |
T |
|
| Q |
218 |
tcctattttatcaagcacaaccttagtgttgccgtcgtggtgctccacatgttctccatttgtatgacacattatataatcatgctcattcacttcgtgc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54496595 |
tcctattttatcaagcacaaccttagtgttgccgtcgtggtgctccacatgttctccatttgtatgacacattatataatcatgctcattcacttcgtgc |
54496496 |
T |
|
| Q |
318 |
ac |
319 |
Q |
| |
|
|| |
|
|
| T |
54496495 |
ac |
54496494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 153 - 274
Target Start/End: Complemental strand, 54504760 - 54504639
Alignment:
| Q |
153 |
acaacgacagccagctttaatcccatcttgcaatgacgctttgttccacttatgaaatgatatactcctattttatcaagcacaaccttagtgttgccgt |
252 |
Q |
| |
|
||||| ||||| |||||||| |||| | |||||||||||||| |||||||||||||||||| || |||| |||| | |||||| ||| | || ||||||| |
|
|
| T |
54504760 |
acaacaacagctagctttaaacccaacctgcaatgacgcttttttccacttatgaaatgatgtattcctgttttcttaagcaccaccattgtattgccgt |
54504661 |
T |
|
| Q |
253 |
cgtggtgctccacatgttctcc |
274 |
Q |
| |
|
||| ||| || ||||| ||||| |
|
|
| T |
54504660 |
cgtagtggtctacatgctctcc |
54504639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University