View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15126_low_51 (Length: 244)
Name: NF15126_low_51
Description: NF15126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15126_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 145 - 228
Target Start/End: Original strand, 8270645 - 8270728
Alignment:
| Q |
145 |
caatggttaaatttgtgaaatataattttttataatgagttattataaacagaatattttatgcagagttactcctcaagtaaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
8270645 |
caatggttaaatttgtgaaatataattttttataatgagttattataaacagaaaattttatgcagagttactcctcaaataaa |
8270728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 14 - 82
Target Start/End: Original strand, 8270513 - 8270582
Alignment:
| Q |
14 |
tggcaagaatagttatgtaattgaataatcgacataacttgtattttg-ataaaaacttattatacattc |
82 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
8270513 |
tggcaataatagttatgtaattgaataatcgacataacttgtattttgaaaaaaaacttattatacattc |
8270582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University