View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15126_low_59 (Length: 220)
Name: NF15126_low_59
Description: NF15126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15126_low_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 19396433 - 19396248
Alignment:
| Q |
16 |
agcatagggttagagaggcttatcaaattgtggagaagattgatgttgtggatataagtgtttatcatggattgataaaagggcttttgaaattgagaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396433 |
agcatagggttagagaggcttatcaaattgtggagaagattgatgttgtggatataagtgtttatcatggattgataaaagggcttttgaaattgagaag |
19396334 |
T |
 |
| Q |
116 |
agcaagtgaagcgactcaagtgtttagggaaatgataaagagaggttgcgaaccaactatgcacacgtatataatgctgttgcagg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396333 |
agcaagtgaagcgactcaagtgtttagggaaatgataaagagaggttgtgaaccaactatgcacacgtatataatgctgttgcagg |
19396248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University