View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15126_low_60 (Length: 218)
Name: NF15126_low_60
Description: NF15126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15126_low_60 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 20 - 203
Target Start/End: Original strand, 7309590 - 7309773
Alignment:
| Q |
20 |
ttcagaattatattcatcaatctcaatcgcacgtctgtttcgagaagcatttcttattctttcatgatcatgatcatcatcagaaccagattcaggatca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
7309590 |
ttcagaattatattcatcaatctcaatcgcacgtctatttcgagaagcatttcttattctttcatgatcatgatcatcatcagaaccagatccaaaatca |
7309689 |
T |
|
| Q |
120 |
tcaatcctatgtctatttcgataagaataatcagacgaagtttgtgtgctcattatttcatgatcattttcagaatcatcattt |
203 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7309690 |
tcaatcctatgcctatttcgataagaataatcagacgaagtttgtgtgctcattatttcatgatcattttcagaatcatcattt |
7309773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University