View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15126_low_63 (Length: 205)
Name: NF15126_low_63
Description: NF15126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15126_low_63 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 205
Target Start/End: Complemental strand, 28036325 - 28036132
Alignment:
| Q |
12 |
agattattctgctcagaataatgctattcgtttgcttgttagtcatcttgcttttgaaaccattcaagaacatagtaagtattctattacaaacaaacaa |
111 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28036325 |
agatcattttgctcagaataatgctattcgtttgcttgttagtcatcttgcttttgaaaccattcaagaacatagtaagtattctattaccaacaaacaa |
28036226 |
T |
|
| Q |
112 |
aacatgccctccttacattctctagttatggctagcaacaccaacaccaatgtccctaacagaagtgataatagcaaaggtgctcatgaagatt |
205 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28036225 |
aacatgtcctccttacattctcttgttatggctagcaacaccaacaccaatgtccctaacagaagcgataatagcaaaggtgctcatgaagatt |
28036132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University