View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15128_high_3 (Length: 231)
Name: NF15128_high_3
Description: NF15128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15128_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 78 - 208
Target Start/End: Original strand, 8315742 - 8315872
Alignment:
| Q |
78 |
tggggttaacacgttttttagataaaaatggcccaaattggnnnnnnnnnnnnnacaaaatgaatttggtaaaaacaaaagagtctcaagtttgaaccct |
177 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8315742 |
tggggttaacccgttttttagataaaaatggcccaaattggttttttagtttttacaaaatgaatttggcaaaaacaaaagagtctcaagtttgaaccct |
8315841 |
T |
 |
| Q |
178 |
gcggcgtcacagtctcaaattctgaacgaga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8315842 |
gcggcgtcacagtctcaaattctgaacgaga |
8315872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 8315652 - 8315687
Alignment:
| Q |
1 |
ttcaatctggattagtaaatttggaggggtataatt |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8315652 |
ttcaatctggattagtaaatttggaggggtataatt |
8315687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University