View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1512_high_12 (Length: 226)
Name: NF1512_high_12
Description: NF1512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1512_high_12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 25245491 - 25245709
Alignment:
| Q |
7 |
catacaatatttcgatggaccttatttaaagagtcacttgaaacatatcttcgattgaacctgacccgaaagattttaattttggtattgnnnnnnntca |
106 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||| ||||||||||||||||||| ||| |
|
|
| T |
25245491 |
cataccatatctcgatggaccttatttaaagagtcacttgaaacatatctttgattgaacccg-cccgaacgattttaattttggtattgaaaaaaatca |
25245589 |
T |
|
| Q |
107 |
aaatttgtattactaaatgaatcgtttcaatttcatctatgttcactatgttaacacgaggactaccgacttcaagaaatccaaattctcttgttagatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25245590 |
aaatttgtattactaaatgaatcgtttcaatttcatctatgttcactgtgttaacacgaggactaccgacttcaagaaatccaaattctcttgttagatt |
25245689 |
T |
|
| Q |
207 |
ggccatgatagctttgattt |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25245690 |
ggccatgatagctttgattt |
25245709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University