View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1512_low_12 (Length: 244)
Name: NF1512_low_12
Description: NF1512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1512_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 40208571 - 40208344
Alignment:
| Q |
1 |
cattaacattgccggtggactcaacaacgaaagctttcaaccttttcattgctagtttcaaagtctcttctgacatgtttgcgaaacacacacgaaacca |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40208571 |
cattaacattgccagtggactcaacaacgaaagctttcaaccttttcattgctagtttcaaagtctcttctgacatgtttgcgaaacacacacgaaacca |
40208472 |
T |
 |
| Q |
101 |
acctggttctgtacaatgacaagatgaaccaggtgaaatgtttaaaccaacttggtacactattttcttccatagttccatttcagcttcaaatgtgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40208471 |
acctggttctgtacaatgacaagatgaaccaggtgaaatgtttaaaccaacttggtacactattttcttccatagttccatttcagcttcaaatgtgttg |
40208372 |
T |
 |
| Q |
201 |
gattggagaagatgcctcatatcaaccc |
228 |
Q |
| |
|
|| ||||||||||||||||||||||||| |
|
|
| T |
40208371 |
gaatggagaagatgcctcatatcaaccc |
40208344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 39 - 228
Target Start/End: Original strand, 5134013 - 5134202
Alignment:
| Q |
39 |
aaccttttcattgctagtttcaaagtctcttctgacatgtttgcgaaacacacacgaaaccaacctggttctgtacaatgacaagatgaaccaggtgaaa |
138 |
Q |
| |
|
||||||||||| |||| || || || |||||||||||||| || ||||| ||||||||||| || ||||| || |||||||| || | ||||||||||| |
|
|
| T |
5134013 |
aaccttttcatagctaagtttaatgtatcttctgacatgttagcaaaacaaacacgaaaccacccaggttcggtgcaatgacatgaagcaccaggtgaaa |
5134112 |
T |
 |
| Q |
139 |
tgtttaaaccaacttggtacactattttcttccatagttccatttcagcttcaaatgtgttggattggagaagatgcctcatatcaaccc |
228 |
Q |
| |
|
|||| || | ||| | | | | ||| ||||||||||| |||||||||||||||||||| || || | ||||| || ||||||||||||| |
|
|
| T |
5134113 |
tgttcaaccgaacatcgaataatatcttcttccatagctccatttcagcttcaaatgtatttgaattaagaaggtgtctcatatcaaccc |
5134202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University