View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1512_low_9 (Length: 251)
Name: NF1512_low_9
Description: NF1512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1512_low_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 40208830 - 40208595
Alignment:
| Q |
16 |
atatatagtaaataacattttttgaactactcctccaagaaataactggggagtgcnnnnnnnnnnnnnnnnnnnnnnnngtgtaatattgtgcatggct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40208830 |
atatatagtaaataacattttttgaactactcctccaagaaataactggggagtgcaaaaagaaaaaaataaaaataaaagtgtaatattgtgcatggct |
40208731 |
T |
 |
| Q |
116 |
agtttcttcaaacttcagcacttnnnnnnnnnnnnnnntacgatcatcaccaatcaccaccaagttaccgttcctcttgttgatcacgttgatcacgaga |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40208730 |
agtttcttcaaacttcagcacttcacacacacacacactacgatcatcaccaatcaccaccaagttaccgttcctcttgttgatcacgttgatcacgaga |
40208631 |
T |
 |
| Q |
216 |
cgataaccgaaaaacccacttagtgagtaaatttct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40208630 |
cgataaccgaaaaacccacttagtgagtaaatttct |
40208595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University