View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15130_high_4 (Length: 232)
Name: NF15130_high_4
Description: NF15130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15130_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 23192074 - 23192272
Alignment:
| Q |
16 |
aattcttatgcttgttattgccaacaaggtgacaactcatgagctatttcttcataatgttttaaaaatcttggttttgtatgtatatctctagtaatta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23192074 |
aattcttatgcttgttattgccaacaaggtgacaactcatgagctatttcttcatgatgttttaaaaatcttggttttgtatgtatatctctagtaatta |
23192173 |
T |
 |
| Q |
116 |
atgtgtatagatttaaagatgttagttttgaactatatacaaatctaaatgaaaacatcgttttatataaatattttcaacaggtcgtcatgaattttt |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23192174 |
atgtgtatagatttagagatgttagttttgaactgtatacaaatctaaatgaaaacatcgttttatataaatattttcatcaggtcgtcatgaattttt |
23192272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University