View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15131_low_17 (Length: 285)
Name: NF15131_low_17
Description: NF15131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15131_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 11 - 246
Target Start/End: Original strand, 42225206 - 42225441
Alignment:
| Q |
11 |
gaaatgaaccccaccatcatatgttcatcaactggtatatataaatataatgatgaaatggtatttcagtgaacataattatatggnnnnnnnnnnnnnn |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225206 |
gaaatgaaccccaccatcatatgttcatcaactggtatatataa------tgatgaaatggtatttcagtgaacataattatatggtttttctttttttc |
42225299 |
T |
|
| Q |
111 |
nnn----acaaaaacataattgtaggtcaatatgctttt--ctctctctcaaaatactcataacatttttgttagtattatccatgttggaacgtgacac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225300 |
tttttatacaaaaacataattgtaggtcaatatgcttttttctctctctcaaaatactcataacatttttgttagtattatccatgttggaacgtgacac |
42225399 |
T |
|
| Q |
205 |
atttttgtcttataactttggaaatatcttatttgtttcttt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225400 |
atttttgtcttataactttggaaatatcttatttgtttcttt |
42225441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University