View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15131_low_19 (Length: 275)
Name: NF15131_low_19
Description: NF15131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15131_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 35676316 - 35676084
Alignment:
| Q |
1 |
ttcatctctatctttgcaaatttaaagttgtctctttttgaaattttcagttagaattacctttttactcatataagactacagcattaagcaatagaat |
100 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35676316 |
ttcatctccatctttgcaaattcaaagttgtctctttttgaaattttcagttagaattacctttttactcatataagactacagcattaagcaatagaat |
35676217 |
T |
|
| Q |
101 |
tgaaaaatctgtactttttggttgctcaaattcaaccttcaaaaatggcatccctaaacacacagcttaatgggttttctttgtccaagttttcttgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35676216 |
tgaaaaatctgtactttttggttgctcaaattcaaccttcaaaaatggcatccctaaacacacagcttaatgggttttctttgtccaagttttcttgtaa |
35676117 |
T |
|
| Q |
201 |
actaagtggtggctacagcctacatgcgtaatg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35676116 |
actaagtggtggctacagcctacatgcgtaatg |
35676084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 43539695 - 43539533
Alignment:
| Q |
1 |
ttcatctctatctttgcaaatttaaagttgt--ctctttttgaaattttcagttagaattacctttttactcatataagactacagcattaagcaataga |
98 |
Q |
| |
|
||||||||||||||||||| || |||||||| |||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
43539695 |
ttcatctctatctttgcaatttcaaagttgtgtctctttttgaaattttcaattataattacctttttactcatataagactacaacattaggcaataga |
43539596 |
T |
|
| Q |
99 |
attgaaaaatctgtactttttggttgctcaaattcaaccttcaaaaatggcatccctaaacaca |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43539595 |
attgaaaaatctgtactttttggttgctcaaattcaaccttc-aaaatggcatccctaaacaca |
43539533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 5 - 83
Target Start/End: Original strand, 29979822 - 29979902
Alignment:
| Q |
5 |
tctctatctttgcaaatttaaagttgtctc--tttttgaaattttcagttagaattacctttttactcatataagactaca |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29979822 |
tctctatctttgcaatttcaaagttgtctctctttttgaaattttcaattagaattacctttttactcatataagactaca |
29979902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University