View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15132_high_13 (Length: 208)
Name: NF15132_high_13
Description: NF15132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15132_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 24 - 194
Target Start/End: Complemental strand, 14948246 - 14948063
Alignment:
| Q |
24 |
ctgaaagtatgcaatttataaaagattgtcttggaataattggagttcatcgcaacaatgaacaatttcaaatctcaatcttttcaaatattatggaaaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14948246 |
ctgaaagtatgcaatttataaaagattgtcttggaataattggagttcatcgcaacaatgaacaatttcaaatctcaatcttttcaaatattatggaaaa |
14948147 |
T |
 |
| Q |
124 |
tcgtt-------------gtaactctcaagtatactttgttctctttcaagatacaaagatgtaccttaccaacatagtattat |
194 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14948146 |
tcgttgcctaaggatgaggtaactctcaagtatactttgttctctttcaagatacaaagatgtaccttaccaacatagtattat |
14948063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 25 - 74
Target Start/End: Complemental strand, 31046261 - 31046212
Alignment:
| Q |
25 |
tgaaagtatgcaatttataaaagattgtcttggaataattggagttcatc |
74 |
Q |
| |
|
||||| |||||||||||||||| | ||||||| ||| ||||||||||||| |
|
|
| T |
31046261 |
tgaaaatatgcaatttataaaataatgtcttgaaatcattggagttcatc |
31046212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University