View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15132_low_12 (Length: 349)
Name: NF15132_low_12
Description: NF15132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15132_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 5e-90; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 52295923 - 52295756
Alignment:
| Q |
18 |
catattggtcaacatttcctctggaataggaacctccagaaccgtatccaacccatctgccttgtcaaaattaggacacaactttctcatggcttgtctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52295923 |
catattggtcaacatttcctctggaataggaacctccagaaccgtatccaacccatctgccttgtcaaaattaggacacaactttctcatggcttgtctt |
52295824 |
T |
 |
| Q |
118 |
tgaagtaacatatatgaagccagattatctttttcacgtacttaaatattagttggagacactaacat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52295823 |
tgaagtaacatatatgaagccagattatctttttcacgtacttaaatattagttggagacactaacat |
52295756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 299 - 344
Target Start/End: Complemental strand, 52295613 - 52295568
Alignment:
| Q |
299 |
aagtttgttatccgggaatcaaacgtttttatgttcgtagaattat |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52295613 |
aagtttgttatccaggaatcaaacgtttttatgttcgtagaattat |
52295568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 246 - 294
Target Start/End: Complemental strand, 52295691 - 52295643
Alignment:
| Q |
246 |
cttcttttatgataaagagagtctctttcctcgtctatttctgcgtatc |
294 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
52295691 |
cttcttttatgataaagaaagtctctttcctcgtctctttctgcgtatc |
52295643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University