View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15132_low_13 (Length: 282)
Name: NF15132_low_13
Description: NF15132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15132_low_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 39979045 - 39979324
Alignment:
| Q |
1 |
aggaacgagagtatatattattccttagcattttccaaaaagttttatggattgaaaacttttctgaatggtaagaatctagaacaccattgactattct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39979045 |
aggaacgagagtatatattattccttagcattttccaaaaagttttatggattgaaaacttttctgaatggtaagaatctagaacaccattgactattct |
39979144 |
T |
 |
| Q |
101 |
ttgcattgggaaaaaatgcacaggaaccataggtacaagtatgttcaatctgtgagaaagcataggtttcgcaggaatcattttgtctaaagtgtggcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39979145 |
ttgcattgggaaaaaatgcacaggaaccataggtacaagtatgttcaatctgtgagaaagcataggtttcgcaggaatcattttgtctaaagtgtggcta |
39979244 |
T |
 |
| Q |
201 |
tctcctcttatcctctcttcaggaagaacatgttgcaatcatacactactatgttttgtagctagctcatcagaattttcac |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39979245 |
tctcctcttatcctctcttcaggaagaacatgttgcaatcatacactactatgttttgtag--agctcatcagaattttcac |
39979324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University