View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15132_low_15 (Length: 234)
Name: NF15132_low_15
Description: NF15132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15132_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 9e-51; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 129 - 230
Target Start/End: Complemental strand, 42403213 - 42403112
Alignment:
| Q |
129 |
ttcagtggcgattcacgacgctgttcttaaaggggaatgggatccgatccatatcacaaatgacggcccacggatatctcaccttctttttgctgatgat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42403213 |
ttcagtggcgattcacgacgctgttcttaaaggggaatgggatccgatccatatcacaaatgacggcccacggatatctcaccttctttttgctgatgat |
42403114 |
T |
|
| Q |
229 |
gt |
230 |
Q |
| |
|
|| |
|
|
| T |
42403113 |
gt |
42403112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 4 - 110
Target Start/End: Complemental strand, 33670061 - 33669955
Alignment:
| Q |
4 |
ttttgggtgttgatttttgaggtgatgcttaccttgtctagtagctatgttgtttttcttttcctttatgcatcagagcatttgtttgtattctaaaaaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33670061 |
ttttgggtgttgatttttgaggtgatacttaccttgtctagtagctatgtagtttttcttttcctttatgcatcagagcatttgcttgtattctaaaaaa |
33669962 |
T |
|
| Q |
104 |
taatgta |
110 |
Q |
| |
|
||||||| |
|
|
| T |
33669961 |
taatgta |
33669955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 139 - 230
Target Start/End: Original strand, 16322610 - 16322701
Alignment:
| Q |
139 |
attcacgacgctgttcttaaaggggaatgggatccgatccatatcacaaatgacggcccacggatatctcaccttctttttgctgatgatgt |
230 |
Q |
| |
|
||||| || ||||||||| ||||| ||||| ||||||||||||| ||||||||| || | |||||||||||| ||||||||||| ||||| |
|
|
| T |
16322610 |
attcaggatgctgttcttcaagggagttgggaaccgatccatatcataaatgacggacctcagatatctcacctcctttttgctgacgatgt |
16322701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 139 - 230
Target Start/End: Complemental strand, 15473432 - 15473341
Alignment:
| Q |
139 |
attcacgacgctgttcttaaaggggaatgggatccgatccatatcacaaatgacggcccacggatatctcaccttctttttgctgatgatgt |
230 |
Q |
| |
|
||||| || ||||||||| ||||| ||||| ||||||||||||||||| ||||| || | |||||||||||| || |||||||||||||| |
|
|
| T |
15473432 |
attcatgatgctgttcttcaagggagttgggaaccgatccatatcacaaacgacgggcctcagatatctcacctcctctttgctgatgatgt |
15473341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University