View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15133_high_17 (Length: 318)
Name: NF15133_high_17
Description: NF15133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15133_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 23226173 - 23226346
Alignment:
| Q |
18 |
ggaatatgagcaatgtgtgaccaaaatgtaacttcaattcaatacaaa-gtgaataatccatggaacttataaacatttttattttagtgtgcacttttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23226173 |
ggaatatgagcaatgtgtgaccaaaatgtaacttcaattcaatacaaaagtgaataatccttggaacttataaacatttttattttagtgtgcacttttc |
23226272 |
T |
|
| Q |
117 |
attcattacaataacatatgcttgtgcgtatagagatttggattattcatgtgtattgcaaaattctacttgaa |
190 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23226273 |
attcattacaatagcatatgcttgtgcgtatcgagatttggattattcatgtgtattgcaaaattctacttgaa |
23226346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 253 - 311
Target Start/End: Original strand, 23226363 - 23226421
Alignment:
| Q |
253 |
acgtttactgtatatcattcaagcattctaggatattggattgctcatgtctcatagca |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23226363 |
acgtttactgtatatcattcaagcattctacgatattggattgctcatgtctcatagca |
23226421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University