View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15133_high_21 (Length: 249)
Name: NF15133_high_21
Description: NF15133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15133_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 35 - 218
Target Start/End: Original strand, 27951612 - 27951795
Alignment:
| Q |
35 |
ggaggagggtgtggtggtggtggatcttagtagctttgtcctcctcttcttctacttcttgttaggtttaattaaatgtgttttatgtatgaatgaaatt |
134 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27951612 |
ggaggtgggtgtggtggtggtggatcttagtagctttgtcctcctcttcttctacttcttgttaggtttaattaaatgtgttttatgtatgaatgaaatt |
27951711 |
T |
 |
| Q |
135 |
ctcactataattgtgtttgagtttgatcaatgtctaaattaaatcgtcaaatttgataaattcccactatgtgttgggtttgga |
218 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
27951712 |
ctcactataattttgtttgagtttgatcgatgtctaaattaaatcgtcaagtttgataaattcccactgtgtgttgggtttgga |
27951795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University