View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15133_high_23 (Length: 243)
Name: NF15133_high_23
Description: NF15133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15133_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 42577955 - 42578166
Alignment:
| Q |
18 |
gtgcaaatagtggataagcagcacaaaactaagttatgaaaagaatgtgcctgtttagatggagcttagagacttggtagaaggataatgggtccagctt |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
42577955 |
gtgcaaatagtggataagcagcactaaactaagttatgaaaagaatgtgcctgtttagttggagcttagagacttgttagaaggataattggtccagctt |
42578054 |
T |
 |
| Q |
118 |
ataagttgatagttctgtttgagtccaattatattaagattagggagaaataaagaaaggaaagagatgagcttaatatacaatgtgataggataagcag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42578055 |
ataagttgatagttctgtttgagtccaattatattaagattagggagaaataaagaaaggaaagagatgagcttaatatacaatgtgataggataagcag |
42578154 |
T |
 |
| Q |
218 |
attttcttcatc |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42578155 |
attttcttcatc |
42578166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 28 - 73
Target Start/End: Original strand, 42570764 - 42570809
Alignment:
| Q |
28 |
tggataagcagcacaaaactaagttatgaaaagaatgtgcctgttt |
73 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42570764 |
tggataagtagcacaaaactaagttctgaaaagaatgtgcctgttt |
42570809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 115 - 150
Target Start/End: Original strand, 42570831 - 42570866
Alignment:
| Q |
115 |
cttataagttgatagttctgtttgagtccaattata |
150 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42570831 |
cttataatttgatagttctgtttgagtccaattata |
42570866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 115 - 163
Target Start/End: Original strand, 42608469 - 42608517
Alignment:
| Q |
115 |
cttataagttgatagttctgtttgagtccaattatattaagattaggga |
163 |
Q |
| |
|
||||||| ||||||||||||||||| || | |||||||||||| ||||| |
|
|
| T |
42608469 |
cttataacttgatagttctgtttgaatctagttatattaagatgaggga |
42608517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University