View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15133_low_15 (Length: 379)
Name: NF15133_low_15
Description: NF15133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15133_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 19 - 367
Target Start/End: Complemental strand, 7562967 - 7562619
Alignment:
| Q |
19 |
atttgagtgtccagttggcgtagttggtgatttgtgtggaggtgattgtgaatttccggatctattggaggctggtggaggacgtcccgctaccggagtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7562967 |
atttgagtgtccagttggcgtagttggtgatttgtgtggaggtgattgtgaatttccagatctattggaggctggtggaggacgtcccgctaccggagtt |
7562868 |
T |
 |
| Q |
119 |
ggtgaatttccggatccattgggggatggtggtgatggtttgtttgatgtaggtggtggaggagaaggttgtgatcctgaaggtggtggcggtggcggtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7562867 |
ggtgaatttccggatccattgggggatggtggggatggtttgtttgatgtaggtggtggaggagaaggttgtgatcctgaaggtggtggcggtggcggtg |
7562768 |
T |
 |
| Q |
219 |
atcctgaaggagacggctgggaatctgaaggtggtgatggtggtggtgattgtggtgactcttctggtggagaatctgaaggcgtcgaagaagagttatc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7562767 |
atcctgaaggagacggctgggaatctgaaggtggtgatggtggtggtgattgtggtgactcttctggtggagaatctgaaggcgtcgaagaagagttatc |
7562668 |
T |
 |
| Q |
319 |
agaatcaggaggggaagacattgttcctattcctttattttcttctcac |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7562667 |
agaatcaggaggggaagacattgttcctattcctttattttcttctcac |
7562619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University