View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15133_low_16 (Length: 357)
Name: NF15133_low_16
Description: NF15133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15133_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 97 - 283
Target Start/End: Complemental strand, 36709512 - 36709327
Alignment:
| Q |
97 |
tgtttgctattgatttgaatttacctccaccaatggatgatgaagaagtgatccgcgtcactaccctgtgtctctgactccccgccgctgtctgtggacc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
36709512 |
tgtttgctattgatttgaatttacctccaccaatggatgatgaagaagtgatccgcgtcactaccctgtgtctctgactccccgccgctgcctgtgga-c |
36709414 |
T |
 |
| Q |
197 |
caatctgctgaagagatgttttttatgttttaattttatgaatgtagtttattgaggctgggnnnnnnntaagagaactttacattg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36709413 |
caatctgctgaagagatgttttttatgttttaattttatgaatgtagtttattgaggctgggaaaaaaataagagaactttacattg |
36709327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 36709596 - 36709567
Alignment:
| Q |
1 |
tcagttcttctgccgcttcagtgaggaagc |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36709596 |
tcagttcttctgccgcttcagtgaggaagc |
36709567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University